valerie2027posada valerie2027posada
  • 23-04-2024
  • Biology
Answered

Codons
Which amino acids does this mRNA strand code for?
*You must spell out the entire name of the amino acid*

5'CCGGAUGUCCGUAUAACGGC3'



Answer :

Other Questions

The perimeter of a rectangle is 150cm. The length is 15cm greater than the width. Find the dimensions
what is 5/12 minus 5/6
A giraffe can run about 14 meters per second. Find it's speed in miles per hour
How are elements and compounds similar
A 50 kg box is at rest on a horizontal surface. When an 80 N force is applied to the box, it slides on the surface with a constant velocity. How will the force
How did world war 1 hurt business in Europe even after the war
The moon is about 240,000 miles from earth . What is the distance written as a whole number multiplied by a power of ten
How do I list these 68.51, 68.15, 68.051, 68.501 in to ascending order (All values are in meters) plz help! :(
What is the difference between hypothesis, theory and scientific law?
write 40,000,000 in scientific notation