You perform PCR using the DNA sequence below as template, a subset of the three primers shown below, and all the usual ingredients, including all 4 dNTPs, thermostable
polymerase, magnesium and buffer.
For your convenience, the regions of the template DNA where the primers may bind are bolded in color
Template (this is double stranded DNA, but only the sequence of one strand is shown here. Each line continues on the next line):
2, - . . AGGAACCAGTCTCAGCATGAAGATCCTTTATCTGCTGTTCGCATTTCTTTTCCT
TGCATTCCTGTCTGAACCAGGGAATGCCTATAAACAGTGTCATAAGAAAGGAGGACACTG
CTTTCCCAAGGAGAAAATATGTCTTCCTCCATCTTCTGACTTTGGGAAGATGGACTGTCG
ATGGAGATGGAAATGCTGTAAAAAGGGAAGTGGAAAATAATGCCATCTCCATCT . . . -3'

Which of the following primer combinations will yield an amplicon?
There may be more than one correct answer.
A. Primers #1 and #3
B. Primers #2 and #3
C. Primers #1 and #2