sterlingsmith8949 sterlingsmith8949

14-06-2024
Biology

Answered

Here is the published sequence for the portion of the PTC gene that you will amplify today.
5’- CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGA
GGCGGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTC
TCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCC
TGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTG
AACCACTGAACCACAGCTACCAAGCCATCATCATGCTAT
GGATGATTGCAAACCAAGCCAACCT -3’
Here is the sequence for the forward/right primer.5’
- CCTTCGTTTTCTTGGTGAATTTTT -3
Underneath the published sequence, write the complementary strand of DNA.Indicate the 5’ and 3’ end of this strand.

Answer :

Other Questions

A body launched from a point reached a distance of 20,000 cm after 6 seconds. What will be the initial velocity of the x axis if the angle of inclination is 45

Answer the question below. Use the rubric in the materials for help if needed.What are some strategies that countries are using to combat terrorism within their

If the vertex is (3,-2), what are the x- and y-intercepts?

Economics Grade 12Instructions and information:1. The final product should meet the following criteria:1.11.2Cover pageA table of content1.3Pages well-arranged

A client who is in the Core Recovery process can still perform planks as long as she doesn’t show any signs of ""bulging.""a. trueb. false

Which of the following is NOT an appropriate consideration when engaging in purposeful planning to determine what you want to teach? O The skill or concept you

Number of DaysWeather Conditions over the Past Month163Sunny Cloudy RainyWeather Condition5Windyposed bydesmosOpen for Weather Conditions Over the Past Month Ba

6. Write an equation to model the problem using a variable, then solve.Six people went out to dinner, split the check, and each paid $18. How much was the check

Nationwide Auto Insurance is well known for its slogan/jingle "Nationwide is on your side." Which of the following is not one of the probable benefits of Nation

A raker-set blade is used for: a. cutting light nonferrous metal b. general applications c. work pieces with changing cross sections d. cutting thin sheet metal