tarathomas84 tarathomas84
  • 18-06-2024
  • Mathematics
Answered

Find the area of a raised vegetable bed having a length of 2 yd and a width of three fourths yd. Write the answer in lowest terms and as a whole or mixed number where possible.



Answer :

Other Questions

who was the founder of Pennsylvania?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
Do you think then solid can undergo convection
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take