CLAYTAJHA46421 CLAYTAJHA46421

04-07-2024
Biology

Answered

The following is a short sequence of dsDNA within Gene X, indicated above with the dashed rectangle. Transcribe the DNA into the appropriate mRNA. Write the RNA in the 5' to 3' direction and do not include spaces. 5' ATCGGGCTACGGGTAACGCTGATTTACG 3' 3' TAGCCCGATGCCCATTGCGACTAAATGC 5'

The mRNA transcribed above will have what modification added to the 5' end? The 3' end?

Answer :

Other Questions

15 is 10% of what number

Use the following statement attributed to the Renaissance humanist Desiderius Erasmus to answer the following question: "Give light, and the darkness will disap

What are the steps to extract metal from the earths crust

so far, Monica has read 5/6 of a book.she has read the same number of pages each day for 5 days. What fraction of the book does Monica read each day?thank you

Please help! Read the information below: In 1840, the population of Chicago was only 4,470. By 1900, the city's population was 1,698,575. Which factor contribut

Kevin claims he can draw a trapezoid with 3 right angles.Is this possible?explain

When you add 18 to 1/4 of a number you get the number itself

What is true about the variable x when the variable n is a negative number?

whats 2/7 divided by 1/7 in simplest form

simplify this algebraic expression, 5(b-4)+25=5x6-5x4