The following is a short sequence of dsDNA within Gene X, indicated above with the dashed rectangle. Transcribe the DNA into the appropriate mRNA. Write the RNA in the 5' to 3' direction and do not include spaces. 5' ATCGGGCTACGGGTAACGCTGATTTACG 3' 3' TAGCCCGATGCCCATTGCGACTAAATGC 5'

The mRNA transcribed above will have what modification added to the 5' end? The 3' end?