cgratz2245 cgratz2245

10-07-2024
Biology

Answered

A newly-synthesized transcript has the sequence UUGCACGGAUGCCUUUGGCCA. What was the sequence of the template strand used in the synthesis of this transcript?
A. UGGCCAAAGGCAUCCUGCAA
B. TGGCCAAAGGCATCCTGCAA
C. TTGCACGGAUGCCTTTGGCCA
D. UUGCACGGAUGCCUUUGGCCA

Answer :

Other Questions

Germany surrendered in May 1945 .. (finish the sentence) A) before the Western Allies crossed the French-German border B) after German officers assassinated Hit

a circle mirror has a diameter of 12 inches. What is the area,in square inches, of the mirror?

What do living things use atp for?

Help!!!!!!!!!!!! I say it is C but I am not sure.

The delegates of Philadelphia decided to write an entirely new and then there's a blank I need the answer

40 pounds of cashews costing $9.20 per pound were mixed with 100 1b of peanuts costing $3.32 per pound. Find the cost of the resulting mixture

Both glycoside and peptide linkages result from dehydration synthesis. A.TRUE B.FALSE

A cone has a base radius of 7 centimeters and a height of 21 centimeters. What is the volume of the cone? A. 28π cm3 B. 49π cm3 C. 147π cm3 D. 343π cm3

Which ordered pair is in Quadrant IV? A. (–3, –5) B. (–3, 5) C. (5, –3) D. (5, 3)

plez help Why did the Japanese government accept the letter Perry brought from President Fillmore in 1853? The government wanted news from the United States. Th