02-04-2015
Biology

Answered

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Answer :

flyingcaprinekid flyingcaprinekid

04-04-2015

the matching (complementary) strand would be:

ATGCCATTCGTAGAACCGTATTGGGGTTAA

Answer Link

Other Questions

To reduce EMI, it is recommended that unshielded low-voltage circuits be separated from power circuits by a minimum distance of:A. 2"B. 12"C. 24"D. 36"

Brad Henderson takes out a mortgage for \[tex]$300,000. This is a 30-year loan at \$[/tex]1,000 per month. This results in a total interest of \$60,000. What is

The slope of the line is 1.5 write the equation of the line in point slope form using the coordinates (4,3) do not use parentheses on the y side

Calculate the length of a wire with a cross-sectional area of [tex]$0.62 \, \text{mm}^2$[/tex] and a resistivity of [tex]$1.8 \times 10^{-7} \, \Omega \cdot \te

Two protons (each with [tex]q = 1.60 \times 10^{-19}[/tex] C) in a nucleus are located [tex]1.00 \times 10^{-15}[/tex] m apart. How much electric force do they

Riko wants to find the distance between the points [tex]$(-2, -3)$[/tex] and [tex]$(2, -5)$[/tex]. His work is shown below:[tex]\[ |-3| + |-5| = 3 + 5 = 8 \][/t

How did Indian art change after Indian Independence in 1947?

A pilot flew out of three different airports in one weekend. First, the pilot flew 2,218 miles from Florida to California. Then, the pilot flew 808 miles from C

which of the following might a chemist choose to study?

Who produces the Food Code?A. CDCB. US-ADAC. FDAD. NBA

In a first aid kit the ratio of large bandages to small is 3 to 2 based on this ratio how many large bandages are in the kit if there are a total of 80 bandages

What is the earliest form of writing?

what is the main idea for the book Helen keller

(has,have) any of the missing packages been located?

Help on these plzzzzz it is really hard

A triangle, ΔABC, is reflected across the x-axis to have the image ΔA'B'C' in the standard (x,y) coordinate plane; thus, A reflects to A'. The coordinates of p

The organ system that forms a communication and coordination network throughout all parts of an animal’s body is known as the (A) digestive system. (B) respirat

how to solve 4n²-3n-7=0

A solution can be both a. Dilute and concentrated b. Saturated and dilute c. Saturated and unsaturated d. Supersaturated and saturated e. None of these

Prove that there is a positive integer that equals the sum of the positive integers not exceeding it. Is your proof constructive or nonconstructive :)