at the end of cytokinesis, how many daughter chromosomes will be found in each cell

Question

20-04-2015
Biology

Answered

at the end of cytokinesis, how many daughter chromosomes will be found in each cell

Answer :

Other Questions

A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?

one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.

Graph the six terms of a finite series where a1 = -3 and r = 1.5.

define concentric circles

On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?

as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash

Give a recursive algorithm for ﬁnding the sum of the ﬁrst n odd positive integers.

How to change 3 7/8 into an improper fraction

Mgd5805 Mgd5805 · Answer 1 · 2015-04-20T21:14:02-04:00

At the end of cytokinesis there no longer exists chromatids, they are just individual chromosomes.

If you're talking about Meiosis, there are 4 (HAPLOID) daughter cells produced at the end of meiosis. So each daughter cell will have HALF the number of chromosomes as the mother cell.

Whereas at the end of Mitosis there are 2 identical DIPLOID sister cells.

Sources~ yahoo answers
And just now learned it last week

Hope this helped ~ Mgd5805 :)