26-05-2015
Mathematics

Answered

how do you work out 5% of 360?

Answer :

Nellz01 Nellz01

26-05-2015

work out 10% - 360/10 = 36
and then divide it by 2 to find 5% (half of 10%!) - 36/2 = 18
Hope this helps :)

Answer Link

unknownb0y1073 unknownb0y1073

06-06-2022

Answer:

18

Step-by-step explanation:

work out 10% - 360/10 = 36

and then divide it by 2 to find 5% (half of 10%!) - 36/2 = 18

Answer Link

Other Questions

What is unexpected about the name of petroleum ether?

work out A+ B as a common vector

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

A rod of length L and mass M has a nonuniform mass distribution. The linear mass density (mass per length) is λ=cx2, where x is measured from the center of the

if 5x+py+8=0 and 10x+15y+12=0 has on solution then p=

Information that is often provided by the supply function includes (Multiple Select)a) Sources of raw materialsb) Technology trendsc) Supplier performance metri

Identify the maximum and minimum of f(x)=x^3-7x^2+10x

Which equations have the variable term isolated to one side of the equals sign, and the constant isolated to the other side, for the equation 5x+ 2x+3? Select a

Keynes's theory that a dollar increase in disposable income will increase consumption but by less than the increase in disposable income, implies a mpc that is

Which of the following phase changes are endothermic? 1) Condensation 2) Melting 3) Deposition 4) None