winner5 winner5

30-05-2015
English

Answered

How did the newspaper editor encourage Wright in his writing?

Answer :

Аноним Аноним

30-05-2015

By stimulating and praising his writing skills he clearly possessed and by giving him several interesting topics to write about. That's after all the job of an editor.

Answer Link

Other Questions

Answers to assessment questions self-reliance by Ralph Waldo Emerson part B which of the following quotes best supports the answer to part a?

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

Allison's starting balance on her credit card was $168.31, and she made purchases of $36.00 and $120.00 during the month. she also made a payment of $200.00. if

Hank begins talking about how cells become the human body. List off the stages, in order

The Intertropical Convergence zone reaches its furthest location north during the ___________. 1) Northern Hemisphere summer 2) This ITCZ stays in the same posi

If 1 T = 10 kHz, determine the maximum bandwidth of Xa(t) allowed such that the overall system from Xa(t) to Ya(t) behaves as an LSI system. (Further details ab

For election polling, a simple random sample of 850 registered voters in district x shows that 58% favor candidate a, and a simple random sample of 1400 registe

describe the layout and features of fish farm

How much energy is lost when the two trains collide (in tons of TNT; the abbreviation for tons is t)?a) ∣w∣=Initial kinetic energy−Final kinetic energyb) ∣w∣=Fi

What is the profit-maximizing price and quantity this monopolist will produce at?a) Q₁ P₂b) Q₂ P₃c) Q₁ P₄d) Q₁ P₁