ghcgg45 ghcgg45
  • 07-05-2024
  • Mathematics
Answered

When annotating the following
sentence, which of the following
is the best annotation?
I was sitting in the dark and
listening to music when suddenly
the walls began to close in on me.
What type of music was playing?
I like being in the sunlight.
I'm too tired to care about this.



Answer :

Other Questions

Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
why did Mr Collins come to the Bennet family looking for a wife?
what are the 2 major types of cofactors?
Why were the committees of correspondence powerful?
how to i do 7/16÷(31/2÷1/2)
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5