faridrebatta123 faridrebatta123
  • 05-06-2024
  • Social Studies
Answered

es del mundo de sofia
solo quiero las frases(de la edad antigua y media) y opinión hasta ese punto
pero que las frases sean del libro o de la peli

es del mundo de sofia solo quiero las frasesde la edad antigua y media y opinión hasta ese punto pero que las frases sean del libro o de la peli class=


Answer :

Other Questions

(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
Explain who or what "Año Viejo" is and its significance.
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
is a centimeter one tenth or one hundredth or a meter
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
p(x) x^3+x^2-x-1 Find all zeros of p (x)