Answered

DIRECTIONS: The following series of letters represent a coded message in a DNA molecule. Match the correct bases to transcribe the message just as DNA does. Next, break the code into codons, being very careful not to lose count or your place. Each codon of your RNA represents a word. Finally, record the words into the written message. Good luck! Double-check to make sure each codon has 3 bases, and that you did not make any errors.

DNA sequence:
TTAAAAGAACAATAAAATGATCATTAT
ATAGTACTATACATTGTTCTTTGCATGGTGCTG
TGGAGGGGCCGCTGTAGCGGGCGGTCTCTAACC
GGAGTTCTTTGCCGTTGCTCAACGGCTGTTCCA
CCATCGACAGCGCCTTGTCCCCCG

The end!

*Aren't you glad this coded DNA is only 150 base pairs long? In our cells, they are often thousands of times longer!



Answer :

GinnyAnswer

Final answer:

Codons in mRNA represent amino acids, and the genetic code is degenerate, allowing multiple codons to specify the same amino acid.


Explanation:

Codons are sets of three bases in mRNA that represent specific amino acids. Each codon codes for a single amino acid, and the sequence of codons determines the sequence of amino acids in a protein. The genetic code is degenerate, meaning one amino acid can be encoded by multiple nucleotide triplets.


Learn more about DNA Codons and Genetic Code here:

https://brainly.com/question/39158302


Other Questions