Answered

Please write out the amino acid sequence that would ultimately be produced from the following sequence of DNA:

TGTTACATACCGTTTATTGGT

Hint: Write the three-letter code for the amino acid followed by a space. For example: Met Pro Arg Met. (Note: Met Pro Arg Met is not the right answer to this question.)



Answer :

GinnyAnswer

Final answer:

Transcribing the given DNA sequence and translating it into amino acids results in the sequence Thr-Met-Cys-Ala-Ile-Thr.


Explanation:

To determine the amino acid sequence from the given DNA sequence TGTTACATACCGTTTATTGGT, we need to transcribe it into mRNA and then translate it into amino acids. The given DNA sequence would transcribe to mRNA as ACAAUGUAUGGCCAAUAACCA. Referencing the genetic code, this mRNA sequence codes for the amino acid sequence Thr-Met-Cys-Ala-Ile-Thr.


Learn more about Amino acid sequence determination from DNA sequence here:

https://brainly.com/question/44008902